Stem-loop sequence gra-MIR8768

AccessionMI0027799 (change log)
DescriptionGossypium raimondii miR8768 stem-loop
Stem-loop
   -      ----                         uguaggucauuucaaaucguuucuc 
5'  uccuuu    ucuuuuccaugucacagagauguug                         u
    ||||||    |||||||||||||||||||||||||                         g
3'  aggaag    agaaaagguauaguguuucuacaac                         c
   g      ugga                         uacgaaggacugauaauuaaagacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr7: 29414742-29414861 [+]
intergenic
Database links

Mature sequence gra-miR8768

Accession MIMAT0034204
Sequence

11 - 

uuccaugucacagagauguug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1