Stem-loop sequence sly-MIR164a

AccessionMI0027570 (change log)
DescriptionSolanum lycopersicum miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention sly-MIR164a
(115 sentences)

Stem-loop
      a     a    ca         c  u          acgcaagauuuaucgauguuucgaaaauucugcuaucauaguacug 
5' ucg gaugg gaag  gggcacgug au acuaacucau                                              u
   ||| ||||| ||||  ||||||||| || ||||||||||                                               
3' agu cuacc cuuu  uccguguac ua ugauugagua                                              a
      a     c    ug         u  u          guaaaauaguguauguacauuucauguuugugauaaacgacauuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr9: 7197971-7198142 [+]
intergenic
Database links

Mature sequence sly-miR164a-5p

Accession MIMAT0033973
Sequence

7 - 

uggagaagcagggcacgugca

 - 27

Get sequence
Evidence experimental; Northern [1]

Mature sequence sly-miR164a-3p

Accession MIMAT0033974
Sequence

148 - 

caugugccuguuuuccccauc

 - 168

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:24085581 "The tomato NAC transcription factor SlNAM2 is involved in flower-boundary morphogenesis" Hendelman A, Stav R, Zemach H, Arazi T J Exp Bot. 64:5497-5507(2013).