Stem-loop sequence atr-MIR535

DescriptionAmborella trichopoda miR535 stem-loop
Gene family MIPF0000136; MIR535
       c                      u    gc  uu        
5' cuug gugacaacgagagagagcacgc ugug  ca  cauguga 
   |||| |||||||||||||||||||||| ||||  ||  |||||| g
3' gaau cacuguugcucuuucucgugcg acac  gu  guacaug 
       c                      u    gu  cc        
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00087: 73178-73268 [+]

Mature sequence atr-miR535

Accession MIMAT0033947

7 - 


 - 27

Get sequence
Evidence experimental; Illumina [1]


PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).