Stem-loop sequence atr-MIR396d

AccessionMI0027538 (change log)
DescriptionAmborella trichopoda miR396d stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   auggugguuuaaggaaacaaggaggaagguuuagggcuuuuuauuggcaaauauggaagguuuaucucaac   -   c uc   c  c   a            a   a  uu  aua   u 
5'                                                                        uga ugg u  aug uu ucc cggcuuucuuga cuu gu  ga   agg g
                                                                          ||| ||| |  ||| || ||| |||||||||||| ||| ||  ||   |||  
3'                                                                        acu acc a  uac aa agg gucgaaagaacu gaa ca  cu   ucc a
   --------------uguuaccgaucuauugaauggaaccucuagauagagagacaacuuucaaguauuaaa   c   u ga   a  a   c            a   -  uu  ---   g 
Get sequence
Deep sequencing
9804 reads, 3.58e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00090: 1850377-1850605 [-]
intergenic
Database links

Mature sequence atr-miR396d

Accession MIMAT0033941
Sequence

88 - 

cuccacggcuuucuugaacuu

 - 108

Get sequence
Deep sequencing9783 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).