Stem-loop sequence atr-MIR396c

AccessionMI0027537 (change log)
DescriptionAmborella trichopoda miR396c stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
        a      ca   aaaga     gugguggaagagauggagagagaauu         ----      c                         uuagu  uu 
5' gagag gugggg  ugu     gcaau                          ggaaguccu    gucaug uuuuccacagcuuucuugaacuucu     cc  g
   ||||| ||||||  |||     |||||                          |||||||||    |||||| |||||||||||||||||||||||||     ||   
3' cuuuc cacccc  acg     cguua                          uuuuuagga    cgguac aaaggguguugaaggaacuugaaga     gg  a
        -      --   -agga     ------------------------au         auaa      c                         ucuac  ua 
Get sequence
Deep sequencing
360597 reads, 1.27e+05 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00046: 1545633-1545816 [+]
intergenic
Database links

Mature sequence atr-miR396c

Accession MIMAT0033940
Sequence

72 - 

uuccacagcuuucuugaacuu

 - 92

Get sequence
Deep sequencing360492 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).