Stem-loop sequence atr-MIR396b

AccessionMI0027536 (change log)
DescriptionAmborella trichopoda miR396b stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   u     aaauu ug    c   -   a                    a    a  ---a    gagaagauug      c u 
5'  gguga     u  gaau cau cgu uuuuuccacagcuuucuuga cuuu uu    auau          ccgcuu g a
    |||||     |  |||| ||| ||| |||||||||||||||||||| |||| ||    ||||          |||||| | a
3'  cuauu     g  cuua gua gua aaaagggugucgaaagaacu gaaa ag    uaua          ggcgaa c u
   g     ----- gu    u   a   c                    c    a  aagg    ---------a      a g 
Get sequence
Deep sequencing
360987 reads, 1.27e+05 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00014: 2855195-2855343 [+]
intergenic
Database links

Mature sequence atr-miR396b

Accession MIMAT0033939
Sequence

30 - 

uuccacagcuuucuugaacuu

 - 50

Get sequence
Deep sequencing360943 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).