Stem-loop sequence atr-MIR396a

AccessionMI0027535 (change log)
DescriptionAmborella trichopoda miR396a stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
       c   g ---a    u      ---------       cuc   a     u         a  cu      accc u     g   ug 
5' ggaa aug a    gauu gaucuu         uuccaug   ucc caggc uucuugaac ug  gcucaa    g cuucu cca  u
   |||| ||| |    |||| ||||||         |||||||   ||| ||||| ||||||||| ||  ||||||    | ||||| |||   
3' ccuu uac u    cugg cuggaa         aagguac   agg guccg aagaauuug ac  ugaguu    c gaaga ggu  u
       a   g aaca    -      cauuaagua       aaa   g     u         a  ag      gaaa -     -   uc 
Get sequence
Deep sequencing
2194 reads, 700 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00013: 1544499-1544667 [+]
intergenic
Database links

Mature sequence atr-miR396a

Accession MIMAT0033938
Sequence

33 - 

uccacaggcuuucuugaacau

 - 53

Get sequence
Deep sequencing2153 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).