Stem-loop sequence pxy-mir-9b-2

AccessionMI0027404 (change log)
DescriptionPlutella xylostella miR-9b-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention pxy-mir-9b-2
(1 sentences)

Stem-loop
   u a   ugcaug    c       cu          c     g     -   u 
5'  g agc      ggcg ggcucgg  cuuugguauc uagcu uaggc guu a
    | |||      |||| |||||||  |||||||||| ||||| ||||| ||| c
3'  c ucg      ccgc ccgggcc  gaagccaugg auuga auccg cga g
   g a   --cuua    u       cu          u     a     g   a 
Get sequence
Deep sequencing
187 reads, 5.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_32: 1410282-1410387 [+]
intergenic
Clustered miRNAs
< 10kb from pxy-mir-9b-2
pxy-mir-9b-2scaffold_32: 1410282-1410387 [+]
pxy-mir-306-2scaffold_32: 1411767-1411851 [+]
Database links

Mature sequence pxy-miR-9b-5p

Accession MIMAT0033807
Sequence

26 - 

ucuuugguauccuag

 - 40

Get sequence
Deep sequencing254 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence pxy-miR-9b-3p

Accession MIMAT0033808
Sequence

64 - 

uaaaguuaugguaccgaagucc

 - 85

Get sequence
Deep sequencing118 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1