Stem-loop sequence pxy-mir-281

AccessionMI0027400 (change log)
DescriptionPlutella xylostella miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

3 open access papers mention pxy-mir-281
(6 sentences)

Stem-loop
   u     a           -ua     c      a  ga 
5'  cuguu augaagagagc   uccgu gacagu uu  c
    ||||| |||||||||||   ||||| |||||| ||  c
3'  ggcaa uauuucucucg   aggua cuguca aa  a
   -     g           uug     -      a  au 
Get sequence
Deep sequencing
958 reads, 2.58e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_377: 158087-158162 [-]
intergenic
Database links

Mature sequence pxy-miR-281

Accession MIMAT0033804
Sequence

48 - 

ugucauggaguugcucucuuua

 - 69

Get sequence
Deep sequencing28 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1