Stem-loop sequence pxy-mir-308

AccessionMI0027315 (change log)
DescriptionPlutella xylostella miR-308 stem-loop
Literature search

2 open access papers mention pxy-mir-308
(6 sentences)

Stem-loop
   aug           u  a    a   -  u 
5'    cgcaguauuau cc guga ugu gu u
      ||||||||||| || |||| ||| ||  
3'    gcgucauaaua gg cacu aca cg c
   uga           -  a    a   u  a 
Get sequence
Deep sequencing
135 reads, 3.52e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (1.0) Overlapping transcripts
scaffold_141: 147570-147629 [-]
intergenic
scaffold_52: 420535-420594 [+]
intergenic
Database links

Mature sequence pxy-miR-308

Accession MIMAT0033723
Sequence

4 - 

cgcaguauuauuccagugaaugu

 - 26

Get sequence
Deep sequencing42 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1