Stem-loop sequence sma-mir-7

AccessionMI0027240 (change log)
DescriptionSchistosoma mansoni miR-7 stem-loop
Stem-loop
   uucua    ---     -gaa  u    a  c        ua        a   uaag     ua 
5'      uguu   ccaga    ac ugga ga uugugauu  guuguuua uau    ugaua  a
        ||||   |||||    || |||| || ||||||||  |||||||| |||    |||||   
3'      acaa   ggucu    ug accu cu aacacuaa  caacaagu aua    auugu  a
   aauca    auu     aaag  u    -  a        --        a   -uaa     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_4: 11989247-11989370 [+]
intergenic
Database links

Mature sequence sma-miR-7-5p

Accession MIMAT0033598
Sequence

21 - 

uggaagacuugugauuuaguug

 - 42

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-7-3p

Accession MIMAT0033599
Sequence

82 - 

caacaaucacaaaucuccau

 - 101

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).