Stem-loop sequence ppc-mir-8288

AccessionMI0026971 (change log)
DescriptionPristionchus pacificus miR-8288 stem-loop
Stem-loop
   ----g       c  a  ga        a  cu 
5'      cauggaa gu uc  uucaccgu ua  u
        ||||||| || ||  |||||||| ||   
3'      guaccuu ca ag  aaguggca gu  g
   gacgg       a  c  -a        a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000003.1: 124844-124906 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8288
ppc-mir-8224ABKE03000003.1: 125624-125688 [-]
ppc-mir-8311ABKE03000003.1: 125411-125473 [-]
ppc-mir-8308ABKE03000003.1: 125279-125333 [-]
ppc-mir-8253ABKE03000003.1: 125073-125130 [-]
ppc-mir-8271ABKE03000003.1: 124956-125015 [-]
ppc-mir-8288ABKE03000003.1: 124844-124906 [-]
Database links

Mature sequence ppc-miR-8288-5p

Accession MIMAT0033085
Sequence

1 - 

gcauggaacguaucgauucaccg

 - 23

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ppc-miR-8288-3p

Accession MIMAT0033086
Sequence

41 - 

ugaaagacacauuccaugggcag

 - 63

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).