Stem-loop sequence ppc-mir-2251b

AccessionMI0026851 (change log)
DescriptionPristionchus pacificus miR-2251b stem-loop
Stem-loop
   --         -         uu      gaa 
5'   aucuccaua aaucccggu  uaucac   u
     ||||||||| |||||||||  ||||||    
3'   uagaggugu uuaggguca  auagug   u
   uc         c         --      aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000093.1: 9033408-9033468 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2251b
ppc-mir-2251aABKE03000093.1: 9033595-9033694 [-]
ppc-mir-2251bABKE03000093.1: 9033408-9033468 [-]
Database links

Mature sequence ppc-miR-2251b-5p

Accession MIMAT0032848
Sequence

1 - 

aucuccauaaaucccgguuuuauc

 - 24

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-2251b-3p

Accession MIMAT0032849
Sequence

39 - 

uaacugggauucuguggagaucu

 - 61

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).