Stem-loop sequence cel-mir-8212

AccessionMI0026848 (change log)
DescriptionCaenorhabditis elegans miR-8212 stem-loop
Stem-loop
   --             ac   a      aucgg 
5'   uugcucaaaaauu  uuc aagucg     c
     |||||||||||||  ||| ||||||      
3'   aacgaguuuuuga  gag uucagc     u
   uc             ca   c      guuac 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11603572-11603635 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-8212
cel-mir-2207chrII: 11600300-11600383 [+]
cel-mir-8212chrII: 11603572-11603635 [+]
Database links

Mature sequence cel-miR-8212-5p

Accession MIMAT0032844
Sequence

1 - 

uugcucaaaaauuacuucaaagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8212-3p

Accession MIMAT0032845
Sequence

42 - 

uucgagacaguuuuugagcaacu

 - 64

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).