Stem-loop sequence cel-mir-8211

AccessionMI0026847 (change log)
DescriptionCaenorhabditis elegans miR-8211 stem-loop
Stem-loop
   --a        -          cgugaa    c 
5'    cucgaggc cggugagcug      augg c
      |||||||| ||||||||||      ||||  
3'    gagcuucg gccgcucggc      uauc g
   caa        a          auuauc    g 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 11936916-11936980 [-]
sense
Y56A3A.7a ; Y56A3A.7a; intron 9
Y56A3A.7b ; Y56A3A.7b; exon 11
Clustered miRNAs
< 10kb from cel-mir-8211
cel-mir-8211chrIII: 11936916-11936980 [-]
cel-mir-86chrIII: 11936637-11936734 [-]
Database links

Mature sequence cel-miR-8211-5p

Accession MIMAT0032842
Sequence

1 - 

acucgaggccggugagcugc

 - 20

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8211-3p

Accession MIMAT0032843
Sequence

43 - 

acggcucgccgagcuucgagaac

 - 65

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).