Stem-loop sequence cel-mir-2217b-2

AccessionMI0026845 (change log)
DescriptionCaenorhabditis elegans miR-2217b-2 stem-loop
Gene family MIPF0001912; mir-2217
Stem-loop
   -- ag  ug    guc  u     u    aa 
5'   c  ag  ggca   gg gucaa cugc  c
     |  ||  ||||   || ||||| ||||  a
3'   g  uu  ucgu   cc caguu gacg  a
   cg cu  gu    guu  -     u    aa 
Get sequence
Deep sequencing
168 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 13619493-13619554 [-]
intergenic
Database links

Mature sequence cel-miR-2217b-5p

Accession MIMAT0032841
Sequence

1 - 

cagagugggcagucggugucaauc

 - 24

Get sequence
Deep sequencing318 reads, 12 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-2217b-3p

Accession MIMAT0032840
Sequence

40 - 

uugacccuugugcuuguuucggc

 - 62

Get sequence
Deep sequencing251 reads, 11 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).