Stem-loop sequence cel-mir-8210

AccessionMI0026843 (change log)
DescriptionCaenorhabditis elegans miR-8210 stem-loop
Stem-loop
   -ugcc       c  gug   c    aaaucg 
5'      uucuuuc uu   ucg cgac      c
        ||||||| ||   ||| ||||      c
3'      aagaaag aa   agc gcug      a
   aaaga       a  aaa   a    ccuaac 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 14656547-14656612 [-]
sense
C54G10.6 ; C54G10.6; exon 1
C54G10.4a ; C54G10.4a; intron 2
C54G10.4b.1 ; C54G10.4b.1; intron 2
C54G10.4b.2 ; C54G10.4b.2; intron 2
C54G10.4c ; C54G10.4c; intron 2
antisense
C54G10.5 ; C54G10.5; exon 1
Database links

Mature sequence cel-miR-8210-5p

Accession MIMAT0032837
Sequence

1 - 

ugccuucuuuccuugugucgccgac

 - 25

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8210-3p

Accession MIMAT0032838
Sequence

43 - 

cgacgaaaaaaagaaagaaagaaa

 - 66

Get sequence
Deep sequencing20 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).