Stem-loop sequence cel-mir-8209

AccessionMI0026842 (change log)
DescriptionCaenorhabditis elegans miR-8209 stem-loop
Stem-loop
   --a        aa           -  ua 
5'    aaacgaag  agaagaagaag ca  g
      ||||||||  ||||||||||| ||   
3'    uuugcuuc  ucuucuucuuc gu  u
   ccc        cc           u  ug 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 7954977-7955033 [+]
sense
T22C1.13 ; T22C1.13; exon 1
Database links

Mature sequence cel-miR-8209-5p

Accession MIMAT0032835
Sequence

1 - 

aaaacgaagaaagaagaagaa

 - 21

Get sequence
Deep sequencing27 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8209-3p

Accession MIMAT0032836
Sequence

36 - 

ucuucuucucccuucguuuccc

 - 57

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).