Stem-loop sequence cel-mir-8208

AccessionMI0026841 (change log)
DescriptionCaenorhabditis elegans miR-8208 stem-loop
Stem-loop
   ---        cag             cgac 
5'    uccgccca   uugaaccaauuag    c
      ||||||||   |||||||||||||    c
3'    aggcgggu   gacuugguuaauc    c
   uca        aag             uuca 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 10856119-10856180 [+]
antisense
T11G6.2b.1 ; T11G6.2b.1; intron 6
T11G6.2b.2 ; T11G6.2b.2; intron 6
T11G6.2a ; T11G6.2a; intron 7
Database links

Mature sequence cel-miR-8208-5p

Accession MIMAT0032833
Sequence

1 - 

uccgcccacaguugaaccaauu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8208-3p

Accession MIMAT0032834
Sequence

40 - 

uugguucaggaaugggcggaacu

 - 62

Get sequence
Deep sequencing44 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).