Stem-loop sequence cel-mir-8207

AccessionMI0026840 (change log)
DescriptionCaenorhabditis elegans miR-8207 stem-loop
Stem-loop
   --    c         cu  uu    -  uuu    gau 
5'   uugu cucuuuucu  ca  ugca ca   uauu   a
     |||| |||||||||  ||  |||| ||   ||||    
3'   agca gagaaaaga  gu  acgu gu   auaa   u
   ag    a         ag  -u    a  --u    acu 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 11722093-11722166 [+]
sense
K01A6.2b ; K01A6.2b; intron 1
K01A6.2a ; K01A6.2a; intron 6
K01A6.2c ; K01A6.2c; intron 6
Database links

Mature sequence cel-miR-8207-5p

Accession MIMAT0032831
Sequence

1 - 

uuguccucuuuucucucauuugca

 - 24

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8207-3p

Accession MIMAT0032832
Sequence

52 - 

cauuggaagaaaagagaacgaga

 - 74

Get sequence
Deep sequencing37 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).