Stem-loop sequence cel-mir-8206

AccessionMI0026839 (change log)
DescriptionCaenorhabditis elegans miR-8206 stem-loop
Stem-loop
   --    u                a auua 
5'   uaua aauguaaucugaaauc c    u
     |||| |||||||||||||||| |     
3'   auau uuacauuagacuuuag g    u
   gg    c                g cuuu 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 6194849-6194906 [-]
intergenic
Database links

Mature sequence cel-miR-8206-5p

Accession MIMAT0032829
Sequence

1 - 

uauauaauguaaucugaaauca

 - 22

Get sequence
Deep sequencing22 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8206-3p

Accession MIMAT0032830
Sequence

38 - 

uuucagauuacauucuauagg

 - 58

Get sequence
Deep sequencing49 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).