Stem-loop sequence cel-mir-8205

AccessionMI0026838 (change log)
DescriptionCaenorhabditis elegans miR-8205 stem-loop
Stem-loop
   --   c     uc u        u   uacaaac 
5'   ugg agacu  g ugaggcua gac       u
     ||| |||||  | |||||||| |||       a
3'   acc uuuga  c acuccgau uug       c
   gc   u     -c c        -   cuuuuaa 
Get sequence
Deep sequencing
112 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 13629835-13629901 [+]
sense
W09C5.2 ; W09C5.2; intron 2
Database links

Mature sequence cel-miR-8205-5p

Accession MIMAT0032827
Sequence

1 - 

uggcagacuucguugaggcua

 - 21

Get sequence
Deep sequencing94 reads, 12 experiments
Evidence experimental; SOLiD [1]

Mature sequence cel-miR-8205-3p

Accession MIMAT0032828
Sequence

45 - 

uuagccucacccaguuuuccacg

 - 67

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).