Stem-loop sequence cel-mir-8196b

AccessionMI0026837
DescriptionCaenorhabditis elegans miR-8196b stem-loop
Gene family MIPF0002057; mir-8196
Stem-loop
   --    u     -u   uu     u     ucu 
5'   ccca agaaa  auu  cuaug caacc   u
     |||| |||||  |||  ||||| |||||    
3'   gggu ucuuu  uaa  gaugu guugg   g
   aa    u     uu   uu     c     cau 
Get sequence
Deep sequencing
5 reads, 14.9 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235) Overlapping transcripts
chrX: 14324406-14324470 [-]
sense
C11H1.12 ; C11H1.12; exon 1
antisense
C11H1.4b ; C11H1.4b; intron 4
C11H1.4a ; C11H1.4a; intron 20

Mature sequence cel-miR-8196b-5p

Accession MIMAT0032825
Sequence

1 - 

cccauagaaauauuuucuauguc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8196b-3p

Accession MIMAT0032826
Sequence

42 - 

uguaguuaauuuuuucuuugggaa

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).