Stem-loop sequence cel-mir-8204

AccessionMI0026836 (change log)
DescriptionCaenorhabditis elegans miR-8204 stem-loop
Stem-loop
   ---       a c      u       a  guuuuu 
5'    uggucuc c acgcgu acucauu au      u
      ||||||| | |||||| ||||||| ||       
3'    accggag g ugcgcg uggguaa ua      u
   cuu       c a      u       c  acuuuu 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 3710171-3710241 [+]
intergenic
Database links

Mature sequence cel-miR-8204-5p

Accession MIMAT0032823
Sequence

1 - 

uggucucaccacgcguuacucauu

 - 24

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; SOLiD [1]

Mature sequence cel-miR-8204-3p

Accession MIMAT0032824
Sequence

47 - 

uggguugcgcguagcgaggccauuc

 - 71

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).