Stem-loop sequence cel-mir-4810b

AccessionMI0026835 (change log)
DescriptionCaenorhabditis elegans miR-4810b stem-loop
Stem-loop
   --       c     -         ag      
5'   guagguu augag uagucauau  guaua 
     ||||||| ||||| |||||||||  |||| u
3'   cauucaa uacuc aucaguaug  caugu 
   ga       c     u         --      
Get sequence
Deep sequencing
23 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 1874016-1874075 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-4810b
cel-mir-4807chrX: 1872466-1872526 [+]
cel-mir-4808chrX: 1872952-1873008 [+]
cel-mir-4809chrX: 1873646-1873704 [+]
cel-mir-2220chrX: 1873827-1873884 [+]
cel-mir-4810bchrX: 1874016-1874075 [+]
cel-mir-4810achrX: 1875738-1875794 [+]
cel-mir-1018chrX: 1879458-1879513 [+]
cel-mir-4925chrX: 1879562-1879620 [+]
cel-mir-4923bchrX: 1879640-1879698 [+]
cel-mir-4923achrX: 1879876-1879936 [+]
cel-mir-4921chrX: 1879979-1880038 [+]
Database links

Mature sequence cel-miR-4810b-5p

Accession MIMAT0032821
Sequence

1 - 

guagguucaugaguagucauau

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-4810b-3p

Accession MIMAT0032822
Sequence

39 - 

ugacuaucucaucaacuuacag

 - 60

Get sequence
Deep sequencing22 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).