Stem-loop sequence cel-mir-8203

AccessionMI0026834 (change log)
DescriptionCaenorhabditis elegans miR-8203 stem-loop
Stem-loop
   --u   c    uuca   -ca      uuuu 
5'    gaa auca    ggg   uuacaa    g
      ||| ||||    |||   ||||||     
3'    cuu uagu    ccc   aauguu    u
   uag   a    caac   aua      uuuc 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 7882764-7882824 [-]
antisense
C39D10.12b ; C39D10.12b; exon 1
Clustered miRNAs
< 10kb from cel-mir-8203
cel-mir-8203chrX: 7882764-7882824 [-]
cel-mir-786chrX: 7882751-7882840 [+]
cel-mir-240chrX: 7882622-7882718 [+]
Database links

Mature sequence cel-miR-8203-5p

Accession MIMAT0032819
Sequence

1 - 

ugaacaucauucagggcauuac

 - 22

Get sequence
Deep sequencing40 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8203-3p

Accession MIMAT0032820
Sequence

38 - 

uaaauaccccaacugauauucgau

 - 61

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).