Stem-loop sequence cel-mir-8202

AccessionMI0026833 (change log)
DescriptionCaenorhabditis elegans miR-8202 stem-loop
Stem-loop
   -----  aa     aaa   g g   uu     ------    gauaa 
5'      ug  cagaa   guc u ugu  caaga      aguc     u
        ||  |||||   ||| | |||  |||||      ||||      
3'      ac  guuuu   cag a acg  guuuu      ucag     a
   cguua  ag     --a   - g   uu     uuuaau    aacuu 
Get sequence
Deep sequencing
334 reads, 12.5 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 6178148-6178231 [-]
intergenic
Database links

Mature sequence cel-miR-8202-5p

Accession MIMAT0032817
Sequence

1 - 

ugaacagaaaaagucgugugu

 - 21

Get sequence
Deep sequencing316 reads, 16 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8202-3p

Accession MIMAT0032818
Sequence

64 - 

agagacauuuuggacaauugc

 - 84

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).