Stem-loop sequence cel-mir-8201

AccessionMI0026832 (change log)
DescriptionCaenorhabditis elegans miR-8201 stem-loop
Stem-loop
   --                  ac    ug 
5'   ucuggaucgauaauguaa  cuau  a
     ||||||||||||||||||  ||||  a
3'   agaccuaguuauuacauu  gaua  u
   ag                  aa    uc 
Get sequence
Deep sequencing
98 reads, 258 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 6294579-6294635 [+]
sense
Y73B6BL.9a ; Y73B6BL.9a; intron 1
Y73B6BL.9b ; Y73B6BL.9b; intron 1
Database links

Mature sequence cel-miR-8201-5p

Accession MIMAT0032815
Sequence

1 - 

ucuggaucgauaauguaaaccu

 - 22

Get sequence
Deep sequencing37 reads, 9 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8201-3p

Accession MIMAT0032816
Sequence

36 - 

aauuacauuauugauccagaga

 - 57

Get sequence
Deep sequencing55 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).