Stem-loop sequence cel-mir-8200

AccessionMI0026831 (change log)
DescriptionCaenorhabditis elegans miR-8200 stem-loop
Stem-loop
   --              a         ug 
5'   uggcucaaaucucc gucagaccc  a
     |||||||||||||| |||||||||   
3'   accgaguuuagagg cagucuggg  u
   cu              g         ug 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 3057062-3057117 [+]
intergenic
Database links

Mature sequence cel-miR-8200-5p

Accession MIMAT0032813
Sequence

1 - 

uggcucaaaucuccagucagacc

 - 23

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8200-3p

Accession MIMAT0032814
Sequence

34 - 

ucugacgggagauuugagccauc

 - 56

Get sequence
Deep sequencing44 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).