Stem-loop sequence cel-mir-8199

AccessionMI0026830 (change log)
DescriptionCaenorhabditis elegans miR-8199 stem-loop
Stem-loop
   --ucgga       --a   g     caaauau   g     aac 
5'        caauauc   cug aucuu       gug auuuc   g
          |||||||   ||| |||||       ||| |||||   u
3'        guuguag   gau uggaa       uau uaaag   g
   auaaaag       gaa   g     -aaagau   g     gcg 
Get sequence
Deep sequencing
571 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 2136822-2136909 [-]
sense
C40A11.10.1 ; C40A11.10.1; exon 2
C40A11.10.2 ; C40A11.10.2; exon 2
Database links

Mature sequence cel-miR-8199-5p

Accession MIMAT0032811
Sequence

1 - 

ucggacaauaucacuggau

 - 19

Get sequence
Deep sequencing53 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8199-3p

Accession MIMAT0032812
Sequence

68 - 

guagaaggauguuggaaaaua

 - 88

Get sequence
Deep sequencing95 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).