Stem-loop sequence cel-mir-8198

AccessionMI0026829 (change log)
DescriptionCaenorhabditis elegans miR-8198 stem-loop
Stem-loop
   -         u  ---    u        --      c 
5'  uugaacagu uc   aauu guuuuuaa  auuguu u
    ||||||||| ||   |||| ||||||||  ||||||  
3'  aacuuguca ag   uuaa uaagaauu  uaacaa a
   a         u  gca    u        uu      c 
Get sequence
Deep sequencing
15351 reads, 88.2 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 16214390-16214461 [-]
sense
H25K10.62 ; H25K10.62; exon 1
H25K10.37 ; H25K10.37; exon 1
Database links

Mature sequence cel-miR-8198-5p

Accession MIMAT0032809
Sequence

1 - 

uugaacaguuucaauuuguu

 - 20

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8198-3p

Accession MIMAT0032810
Sequence

52 - 

uaauuacggauacuguucaaa

 - 72

Get sequence
Deep sequencing15327 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).