Stem-loop sequence cel-mir-8197

AccessionMI0026828 (change log)
DescriptionCaenorhabditis elegans miR-8197 stem-loop
Stem-loop
   --  u        ccac       g aa   auua 
5'   ag gcuuugcu    ccaacuc u  cca    g
     || ||||||||    ||||||| |  |||     
3'   uc uggaacga    gguugag a  ggu    a
   ag  u        -aac       g ag   agaa 
Get sequence
Deep sequencing
116 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 15150353-15150421 [+]
sense
T09F5.1 ; T09F5.1; intron 5
Database links

Mature sequence cel-miR-8197-5p

Accession MIMAT0032807
Sequence

1 - 

agugcuuugcuccacccaacuc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8197-3p

Accession MIMAT0032808
Sequence

49 - 

guuggcaaagcaagguucuga

 - 69

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).