Stem-loop sequence cel-mir-8196a

AccessionMI0026827 (change log)
DescriptionCaenorhabditis elegans miR-8196a stem-loop
Gene family MIPF0002057; mir-8196
Stem-loop
   --c    u     u   uu     u     ucu 
5'    ccca agaaa auu  cuaug caacc   u
      |||| ||||| |||  ||||| |||||    
3'    gggu ucuuu uaa  gaugc guugg   g
   uaa    u     u   uu     c     cac 
Get sequence
Deep sequencing
1088 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2329038-2329103 [+]
sense
T01B6.11 ; T01B6.11; exon 1
T01B6.12 ; T01B6.12; exon 1
Database links

Mature sequence cel-miR-8196a-5p

Accession MIMAT0032805
Sequence

1 - 

ccccauagaaauauuuucuauguc

 - 24

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8196a-3p

Accession MIMAT0032806
Sequence

44 - 

guaguuaauuuuucuuugggaau

 - 66

Get sequence
Deep sequencing1072 reads, 17 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).