Stem-loop sequence cel-mir-8195

AccessionMI0026826 (change log)
DescriptionCaenorhabditis elegans miR-8195 stem-loop
Stem-loop
   --    -    -  -  -g    ---     acu 
5'   gucg agcu gu cc  uacu   cgucg   a
     |||| |||| || ||  ||||   |||||    
3'   cagu ucga ca gg  auga   gcagc   u
   gg    g    g  u  ag    acc     caa 
Get sequence
Deep sequencing
112 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 2464028-2464088 [+]
antisense
F53G2.6 ; F53G2.6; exon 12
Database links

Mature sequence cel-miR-8195-5p

Accession MIMAT0032803
Sequence

1 - 

gucgagcuguccguacucgucg

 - 22

Get sequence
Deep sequencing10 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8195-3p

Accession MIMAT0032804
Sequence

40 - 

guagagguacgagcugugacgg

 - 61

Get sequence
Deep sequencing101 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).