Stem-loop sequence cel-mir-8194

AccessionMI0026825 (change log)
DescriptionCaenorhabditis elegans miR-8194 stem-loop
Stem-loop
   --            aaag         g 
5'   augcgccuuuaa    guacgguag u
     ||||||||||||    |||||||||  
3'   uacgcggaaauu    caugccauu g
   cg            cuca         a 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 1221313-1221368 [-]
intergenic
Database links

Mature sequence cel-miR-8194-5p

Accession MIMAT0032801
Sequence

1 - 

augcgccuuuaaaaagguacgg

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8194-3p

Accession MIMAT0032802
Sequence

35 - 

guacacucuuaaaggcgcaugc

 - 56

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).