Stem-loop sequence cel-mir-8193

AccessionMI0026824 (change log)
DescriptionCaenorhabditis elegans miR-8193 stem-loop
Stem-loop
   --        ua uc             aa 
5'   cgcgggac  g  aagugucggcugc  c
     ||||||||  |  |||||||||||||  c
3'   gcguuuug  c  uucacagccgacg  a
   aa        gc -u             ag 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 2538611-2538670 [+]
sense
Y23H5B.4 ; Y23H5B.4; intron 2
Database links

Mature sequence cel-miR-8193-5p

Accession MIMAT0032799
Sequence

1 - 

cgcgggacuagucaagugucggc

 - 23

Get sequence
Deep sequencing48 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8193-3p

Accession MIMAT0032800
Sequence

39 - 

cgacacuuuccgguuuugcgaa

 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).