Stem-loop sequence cel-mir-8192

AccessionMI0026823 (change log)
DescriptionCaenorhabditis elegans miR-8192 stem-loop
Stem-loop
   --c    g  c       ag       ---u     u   u 
5'    gguc ag gagucuc  ucggccg    ggcgg gcg u
      |||| || |||||||  |||||||    ||||| |||  
3'    ccgg uu cucagag  agccggu    ucguc cgu g
   cgu    g  a       aa       gugu     -   a 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 6943941-6944018 [+]
sense
F22D3.9 ; F22D3.9; exon 1
F22D3.2h ; F22D3.2h; intron 2
F22D3.2a ; F22D3.2a; intron 13
F22D3.2d ; F22D3.2d; intron 13
F22D3.2e ; F22D3.2e; intron 13
F22D3.2g ; F22D3.2g; intron 13
Database links

Mature sequence cel-miR-8192-5p

Accession MIMAT0032797
Sequence

1 - 

cggucgagcgagucucagucggc

 - 23

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8192-3p

Accession MIMAT0032798
Sequence

56 - 

cgaaagagacucauugggccugc

 - 78

Get sequence
Deep sequencing21 reads, 8 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).