Stem-loop sequence cel-mir-8190

AccessionMI0026821 (change log)
DescriptionCaenorhabditis elegans miR-8190 stem-loop
Stem-loop
   --cg        cuuu       ag     cc 
5'     ggaaaucg    ggaaucc  gaaau  g
       ||||||||    |||||||  |||||   
3'     cuuuuagc    ccuuagg  cuuua  g
   gcga        -cau       -g     ag 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 11096994-11097055 [+]
antisense
W02B9.1b ; W02B9.1b; intron 21
Database links

Mature sequence cel-miR-8190-5p

Accession MIMAT0032793
Sequence

1 - 

cgggaaaucgcuuuggaauccagga

 - 25

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-8190-3p

Accession MIMAT0032794
Sequence

43 - 

auuccuaccgauuuucagcg

 - 62

Get sequence
Deep sequencing13 reads, 6 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).