Stem-loop sequence cel-mir-8189

AccessionMI0026820 (change log)
DescriptionCaenorhabditis elegans miR-8189 stem-loop
Stem-loop
   --                   c a ug  agc  -  u 
5'   ucucuuauccacuaggcca g g  cc   gc cc c
     ||||||||||||||||||| | |  ||   || ||  
3'   ggagaauaggugauccggu c c  gg   ug gg a
   ag                   a g cu  -gc  a  a 
Get sequence
Deep sequencing
494 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 2079009-2079082 [+]
intergenic
Database links

Mature sequence cel-miR-8189-5p

Accession MIMAT0032791
Sequence

1 - 

ucucuuauccacuaggccacga

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SOLiD [1]

Mature sequence cel-miR-8189-3p

Accession MIMAT0032792
Sequence

53 - 

auggccuaguggauaagaggga

 - 74

Get sequence
Deep sequencing452 reads, 12 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).