Stem-loop sequence cel-mir-8187

AccessionMI0026818 (change log)
DescriptionCaenorhabditis elegans miR-8187 stem-loop
Stem-loop
   --   ggaa       -----          c        agg 
5'   ucg    ugccuac     gccugcuuac ugccuauu   c
     |||    |||||||     |||||||||| ||||||||    
3'   agc    acggaug     cggacggaug acggauaa   a
   gu   ----       uagaa          c        ggu 
Get sequence
Deep sequencing
309981 reads, 912 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 14368397-14368473 [-]
sense
Y105E8A.4 ; Y105E8A.4; intron 2
Database links

Mature sequence cel-miR-8187-5p

Accession MIMAT0032787
Sequence

1 - 

ucgggaaugccuacgccugc

 - 20

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence cel-miR-8187-3p

Accession MIMAT0032788
Sequence

57 - 

aggcaagauguaggcacgaug

 - 77

Get sequence
Deep sequencing309966 reads, 17 experiments
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).