Stem-loop sequence cel-mir-8186-1

AccessionMI0026816 (change log)
DescriptionCaenorhabditis elegans miR-8186-1 stem-loop
Gene family MIPF0002035; mir-8186
Stem-loop
   -                         caua 
5'  acugcucaaaggacuuugcugcaaa    c
    |||||||||||||||||||||||||     
3'  ugacgaguuuccugaaacgacguuu    u
   u                         aaac 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 18638-18698 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-8186-1
cel-mir-8186-2chrII: 18637-18697 [-]
cel-mir-8186-1chrII: 18638-18698 [+]
Database links

Mature sequence cel-miR-8186-5p

Accession MIMAT0032785
Sequence

1 - 

acugcucaaaggacuuugcugc

 - 22

Get sequence
Deep sequencing26 reads, 6 experiments
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence cel-miR-8186-3p

Accession MIMAT0032786
Sequence

40 - 

cagcaaaguccuuugagcaguu

 - 61

Get sequence
Deep sequencing28 reads, 6 experiments
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).