Stem-loop sequence ath-MIR8176

AccessionMI0026806 (change log)
DescriptionArabidopsis thaliana miR8176 stem-loop
Literature search

1 open access papers mention ath-MIR8176
(1 sentences)

Stem-loop
   ----u   uugaa         -aucu   c     -   --  a       u 
5'      aga     uaagaagcu     ggc ggugg ucg  cg gagggau u
        |||     |||||||||     ||| ||||| |||  || |||||||  
3'      ucu     auucuuuga     ucg cuacu agc  gc cucucua a
   guuuu   uuuac         gccau   u     u   ug  -       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 11795177-11795275 [+]
intergenic
Database links

Mature sequence ath-miR8176

Accession MIMAT0032775
Sequence

23 - 

ggccgguggucgcgagaggga

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).