Stem-loop sequence ssa-mir-8164

AccessionMI0026792 (change log)
DescriptionSalmo salar miR-8164 stem-loop
Literature search

1 open access papers mention ssa-mir-8164
(1 sentences)

Stem-loop
   --     g      aa       auacuac 
5'   cagag uauugu  uaucgug       a
     ||||| ||||||  |||||||        
3'   gucuu auagcg  auagcac       a
   ua     a      gc       cacucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-8164-5p

Accession MIMAT0032759
Sequence

1 - 

cagagguauuguaauaucguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-8164-3p

Accession MIMAT0032760
Sequence

39 - 

acgauacggcgauaauucugau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1