Stem-loop sequence ssa-mir-7552a-2

AccessionMI0026789 (change log)
DescriptionSalmo salar miR-7552a-2 stem-loop
Gene family MIPF0001916; mir-7552
Literature search

1 open access papers mention ssa-mir-7552a-2
(1 sentences)

Stem-loop
   ---uu        a   u      ug gauug 
5'      acaauuaa gga auuucu  c     a
        |||||||| ||| ||||||  |      
3'      uguuaauu ccu uaaagg  g     a
   cgguu        c   u      ca aguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-7552a-5p

Accession MIMAT0032752
Sequence

1 - 

uuacaauuaaaggauauuucuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-7552a-2-3p

Accession MIMAT0032754
Sequence

42 - 

aaauuucccuuaauuguuuggc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1