Stem-loop sequence ssa-mir-7552a-1

AccessionMI0026788 (change log)
DescriptionSalmo salar miR-7552a-1 stem-loop
Gene family MIPF0001916; mir-7552
Literature search

1 open access papers mention ssa-mir-7552a-1
(1 sentences)

Stem-loop
   ---uu        a          ug gaaug 
5'      acaauuaa ggauauuucu  c     a
        |||||||| ||||||||||  |      
3'      uguuaauu ccuguaaagg  g     a
   cgguu        c          ca agagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-7552a-5p

Accession MIMAT0032752
Sequence

1 - 

uuacaauuaaaggauauuucuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-7552a-3p

Accession MIMAT0032753
Sequence

42 - 

aaaugucccuuaauuguuuggc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1