Stem-loop sequence ssa-mir-2184

AccessionMI0026784 (change log)
DescriptionSalmo salar miR-2184 stem-loop
Literature search

1 open access papers mention ssa-mir-2184
(5 sentences)

Stem-loop
   --aaca        ua         guu 
5'       guaagagu  augugcugg   c
         ||||||||  |||||||||    
3'       cauucucg  ugcacgacu   u
   acauga        ga         aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-2184-5p

Accession MIMAT0032744
Sequence

1 - 

aacaguaagaguuaaugugcug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-2184-3p

Accession MIMAT0032745
Sequence

35 - 

gcacguaggcucuuacaguaca

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1