Stem-loop sequence ssa-mir-8157

AccessionMI0026780 (change log)
DescriptionSalmo salar miR-8157 stem-loop
Literature search

1 open access papers mention ssa-mir-8157
(5 sentences)

Stem-loop
   -       u  c       cu    --   u 
5'  uagcaca ua aguacag  guau  ugu a
    ||||||| || |||||||  ||||  |||  
3'  gucgugu gu ucguguc  caug  acg c
   u       c  c       -u    uc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-8157-5p

Accession MIMAT0032736
Sequence

1 - 

uagcacauuacaguacagcugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-8157-3p

Accession MIMAT0032737
Sequence

39 - 

acucugugcucugcugugcugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1