Stem-loop sequence ssa-mir-9b

AccessionMI0026777 (change log)
DescriptionSalmo salar miR-9b stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc       a       ga    -   u 
5'     uuugguu ucuagcu  auga guu a
       ||||||| |||||||  |||| ||| u
3'     aagccaa agaucga  uacu uag g
   augu       g       aa    a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9b-5p

Accession MIMAT0032730
Sequence

1 - 

ucuuugguuaucuagcugaau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9b-3p

Accession MIMAT0032731
Sequence

39 - 

uaaagcuagagaaccgaaugua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1