Stem-loop sequence ssa-mir-9a-8

AccessionMI0026776 (change log)
DescriptionSalmo salar miR-9a-8 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc               g      ug  g 
5'     uuugguuaucuagcu uaugag  gu u
       ||||||||||||||| ||||||  ||  
3'     aagccaauagaucga auacuu  ua a
   auga               a      cu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-8-3p

Accession MIMAT0032729
Sequence

41 - 

uaaagcuagauaaccgaaagua

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1