Stem-loop sequence ssa-mir-9a-6

AccessionMI0026774 (change log)
DescriptionSalmo salar miR-9a-6 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc        u      g     gu  ua 
5'     uuugguua cuagcu uauga  gu  c
       |||||||| |||||| |||||  ||   
3'     aagccaau gaucga auacu  cg  u
   augu        c      a     gc  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-9a-5p

Accession MIMAT0032721
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-9a-6-3p

Accession MIMAT0032727
Sequence

41 - 

uaaagcuagcuaaccgaaugua

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1